ARTICLE

Md-ACS1 및 Md-ACO1 분자표지를 이용한 국내육성사과의 저장성 예측

권영순1,2, 권순일1, 김선애1, 권헌중1, 유진기2, 류슬기2, 강인규2, 김정희1,*
Young Soon Kwon1,2, Soon-Il Kwon1, Seon Ae Kim1, Hun-Joong Kweon1, Jingi Yoo2, Seulgi Ryu2, In-Kyu Kang2, Jeong-Hee Kim1,*
Author Information & Copyright ▼
1농촌진흥청 국립원예특작과학원 사과연구소
2경북대학교 원예과학과
1Apple Research Institute, National Institute of Horticultural and Herbal Science, RDA, Gunwi 39000, Korea
2Department of Horticultural Science, Kyungpook National University, Daegu 41566, Korea
*Corresponding author : peat1004@korea.kr82-54-380-3132, 82-54-380-3125

© The Korean Society of Food Preservation. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Sep 6, 2017; Revised: Nov 7, 2017; Accepted: Nov 8, 2017

Abstract

Apple (Malus domestica) is a climacteric fruit because of its high respiration and ethylene production. Ethylene affects the fruit by decreasing its quality and storability. Md-ACS1 and Md-ACO1 genes are involved in ethylene biosynthesis in apple; the Md-ACS1-2 and Md-ACO1-1 alleles are associated with low ethylene production. We conducted an analysis to study Md-ACS1 and Md-ACO1, and to examine ethylene production and softening rate of fruit at room temperature (20°C) storage in ‘Fuji (FJ)’, ‘Golden Supreme (GS)’, and 5 cultivars of Korean apples (‘RubyS (RS)’, ‘Hongro (HR)’, ‘Arisoo (AS)’, ‘Summer King (SK)’, ‘Greenball (GB)’). The result showed that an increase in the number of the alleles (ACS1-2, ACO1-1) decreased the ethylene production and softening rate. The presence of ACS1-1/1, ACO1-1/2 was confirmed in GS and the highest ethylene production and softening rate was observed. Ethylene production and softening rate of SK and GB expressing ACS1-1/2, ACO1-1/2 were higher than that of HR and AS, expressing ACS1-2/2, ACO1-1/2, but lower than GS. FJ with ACS1-2/2, ACO1-1/1 showed the lowest ethylene production and softening rate among all cultivars except RS. The Md-ACS1 and Md-ACO1 DNA markers could potentially be used to estimate storability and applied in marker assisted selection the improve the efficiency of apple breeding.

Keywords: DNA marker; ethylene; firmness; Malus domestica

서 론

과실의 성숙과 노화를 촉진하는 것으로 알려진 식물호르 몬 에틸렌은 methionine을 전구물질로 하여 생성된다(1). 에틸렌 생합성의 첫 번째 과정은 S-adenosylmethionine (AdoMet)을 에틸렌의 직접적인 전구체인 1-aminocyclopropane- 1-carboxylic acid(ACC)로 전환하는 것인데 ACC synthase (ACS)에 의해 이루어진다. AdoMet으로 부터 전환 된 ACC 는 ACC oxidase(ACO)에 의해 최종적으로 에틸렌이 된다 (2). 식물체 내에서 에틸렌의 수준은 ACS와 ACO 유전자 활성에 의해 결정되며, 사과에서도 Md-ACS와 Md-ACO 유 전자들이 밝혀져 있다. Md-ACS 유전자에는 Md-ACS1, Md-ACS2, Md-ACS3a, Md-ACS3b, Md-ACS3c, Md-ACS5A, Md-ACS5B 등 19개가 보고 되어있으나, Md-ACS1이 사과의 에틸렌 발생과 성숙에 가장 우세하게 작용한다(3). Md-ACO 유전자들 중에서는 Md-ACO1이 에틸렌 생합성에 가장 우세하게 발현되며, Md-ACS1에 비해서는 에틸렌 생 합성에 미치는 영향이 약한 편이지만 독립적으로 역할을 하는 것으로 알려져 있다(4). Md-ACS1와 Md-ACO1은 대립 유전자 조합에 따라 에틸렌 발생량의 차이를 보인다. ACS1 의 대립유전자 조합에 따른 에틸렌 발생량은 ACS1-2/2가 가장 낮고, ACS1-1/2은 중간 정도이며 ACS1-1/1은 가장 많 이 발생된다. ACO1의 경우에는 ACO1-1/1가 가장 낮고, ACO1-1/2은 중간 정도이며 ACS1-2/2은 가장 많이 발생된 다(5).

에틸렌은 과실 내 호흡, 조직 연화 등 여러 가지 생리 반응을 조절하고 저장이나 유통 중 경도, 중량 및 유기산 함량을 감소시켜 상품성을 급격히 떨어뜨리는 원인이 된다 (6). 또한 저장 중 과실로부터 발생 된 에틸렌은 다시 과실에 영향을 미쳐서 노화를 더욱 촉진한다. 사과는 성숙이 진행 되면서 에틸렌에 의해 호흡량이 일시적으로 상승하는 호흡 급등형 과실이다. 에틸렌 발생은 세포벽분해효소 활성화 및 세포벽 연화를 진행시켜 사과의 상품성과 저장성을 떨어 뜨리는 원인된다(7).

과육의 연화와 분질화를 막고, 과실 품질 유지 기간을 늘리기 위해서 에틸렌 작용 억제제인 1-methylcyclopropene (1-MCP)와 에틸렌 생합성 억제제인 aminoethoxyvinylglycine (AVG) 처리기술에 대한 많은 연구가 진행되고 있으며 사과 ‘Jonathan’, ‘Fuji’, ‘Gamhong’ 품종의 저장 중 경도, 산 함량 등 과실 특성 유지 및 에틸렌 발생량 감소에 효과를 나타내 는 것으로 보고되었다(8-10). 사과뿐만 아니라, 토마토, 복 숭아 등 호흡급등형 과실의 에틸렌 제어제 개발, 처리기술 과 관련한 많은 노력과 비용이 투입되고 있다(11,12).

사과의 저장성은 수많은 환경적 요인, 재배관리, 수확시 기, 저장방법에 따라 달라지지만 품종이 가지고 있는 고유 한 유전적 요인이 에틸렌 발생, 경도 등 저장성 특성에 가장 큰 영향을 미친다(13). 따라서 에틸렌 발생이 낮은 유전적 특성을 가진 품종은 저장성이 좋아서 유통 기간을 안정적으 로 확보할 수 있으며, 소비자들에게 품질 변화가 적은 과실 을 제공할 가능성을 높일 수 있다. 또한 에틸렌 제어제 개발 및 처리에 대한 경제적 부담을 줄일 수 있을 것이다.

국외에서는 Md-ACS1와 Md-ACO1 분자표지를 사과의 저장성 예측과(14) 육종과정 중 저장성 형질과 관련 한 조기 선발 marker assisted selection(MAS)에 적용하고 있으나 (15), 아직 국내에서는 연구된 바가 없다. 본 연구에서는 국내에서 개발 된 사과 28품종의 Md-ACS1와 Md-ACO1 대립유전자형을 구명하고 수확 후 에틸렌 발생량 및 경도 연화율을 조사하여 Md-ACS1와 Md-ACO1 분자표지를 국내 의 사과 저장성 예측 및 육종 효율 향상을 위한 MAS에 활용할 수 있는지를 검증하고자 수행하였다.

재료 및 방법

실험재료 및 DNA 추출

농촌진흥청 국립원예특작과학원에서 육성한 28품종과 국외에서 개발된 저장성이 강한 ‘Fuji’와 저장성이 약한 ‘Golden Supreme’ 품종을 실험재료로 선정하고, 경상북도 군위군에 위치한 농촌진흥청 국립원예특작과학원 사과연 구소의 유전자원 보존포에 재식된 나무를 사용하였다. Md-ACS1 및 Md-ACO1 대립유전자형 분석은 30품종 모두 실시하였고, 대립유전자형 조합별로 대표되는 7품종 (‘Fuji', ’RubyS', ‘Hongro', ‘Arisoo', ‘Summer King', ‘Greenball', ‘Golden Supreme')을 대상으로 과실의 에틸렌 발생량 및 경도 조사를 수행하였다.

품종별 genomic DNA 추출은 신초를 채취하여 액체질소 와 막자사발로 곱게 마쇄한 후 DNeasy plant mini kit(Qiagen, Valencia, CA, USA)를 사용하였다. 추출한 DNA 는 0.8% agarose gel 에 전기 영동하여 순도를 확인하고 분광광도계(BioTek, Winooski, VT, USA)로 정량분석 하였 다. PCR 분석에 이용하기 위하여 DNA를 20 ng·μL-1 의 농도로 희석하였다.

Md-ACS1 및 Md-ACO1 primer를 이용한 PCR 분석

Md-ACS1 및 Md-ACO1 대립유전자형 분석을 위하여 Sunako 등(16)과 Costa 등(5)이 보고한 primer를 실험에 사 용하였다(Table 1). PCR 반응은 Maxime PCR Premix kit(i-starTaq, iNtRON Biotechnology, Seongnam, Korea)를 이용하여 gDNA 20 ng, primer 10 μM, distilled water 17 μL 를 첨가하여 총 20 μL 반응액으로 수행하였다. PCR은 C1000 thermocycler(Bio-Rad, Hercules, CA, USA)를 사용하 여 95℃에서 1분간 초기 변성 후 95℃에서 15초, 58℃ 및 65℃에서 15초, 72℃에서 10초로 35회 반복하고 72℃에서 10분간 처리 후 반응을 종료하였다. PCR 산물은 1.2% agarose gel 에서 전기 영동하여 확인하였다.

Table 1. Primer sequences used for amplifying Md-ACS1 and Md-ACO1 genes
Gene Primer sequences Amplicon size (bp) Annealing temperature (℃) Reference
Md-ACS1 Forward 5′ AGAGAGATGCCATTTTTGTTCGTAC 3′ 1:489 58 Sunako et al (17)
Reverse 5′ CCTACAAACTTGCGTGGGGATTATAAGTGT 3′
Md-ACO1 Forward 5′ TCCCCCCAATGCACCACTCCA 3′ 1:525 65 Costa et al (5)
Reverse 5′ GATTCCTTGGCCTTCATAGCTTC 3′
Download Excel Table
에틸렌 발생량 측정

에틸렌 발생량은 과실 수확일 부터 상온저장(20℃) 25일 까지 조사하였다. 조생종으로 품질변화가 빠르게 발생하는 ‘Golden Supreme’과 ‘Summer King’은 2일 간격으로 측정하 고, 그 외 ‘Arisoo’ 등 5품종은 3일 간격으로 측정하였다. 3개의 과실을 1반복으로 하여 15개의 과실을 조사 하였다. 1.6 L 밀폐용기에 소과종인 ‘RubyS'는 3개의 과실을 넣고, 나머지 품종들은 1개의 과실을 넣고 1시간 후 head space에 서 1 mL gas 시료를 채취하여 각각 FID(flame ionization detector)와 TCD(thermal conductivity detector)를 장착한 gas chromatography(GC2010, Shimadzu Co., Kyoto, Japan)를 이 용하여 측정하였다. FID 분석조건은 Porapak Q(80/100 2 m, Restek, Bellefonte, PA, USA) column을 이용하였고, injector, oven, detector 온도는 각각 100, 90, 200℃로 설정하 였으며, flow rate는 He carrier, H2, Air를 각각 25, 40, 400 mL/min로 하였다.

경도 조사

과실의 경도는 수확일 및 수확 후 상온 저장 20일에 각각 조사하였다. 조사 방법은 과실 당 적도면 세 방향에 과피를 얇게 벗겨내고 11 mm plunger를 장착한 과실경도계(Fruit firmness tester, DFT-01, TR snc, Italy)를 이용하여 측정 후 평균값을 사용하였다. 3과실을 1반복으로 총 3반복하여 평 균(Mean)±표준편차(standard deviation, SD)로 표시하였다.

경도 연화율은 수확일의 경도에서 수확 후 상온 저장 20일의 경도를 뺀 값에서 상온 저장 기간 20일을 나누어 계산하였다. 통계분석은 Statistic Analysis System(SAS v 9.4 Institute Inc., Cary, NC, USA)을 이용하여 ANOVA 분석 을 행한 후 p<0.05 수준에서 Duncan's multiple range test를 실시하여 유의성을 검증하였다.

결과 및 고찰

사과 국내육성품종의 Md-ACS1와 Md-ACO1 유전자형

사과 국내육성 28품종의 과실 특성과 Md-ACS1와 Md-ACO1 유전자형을 분석한 결과는 Table 2와 같다. ACS1-2와 ACO1-1은 낮은 에틸렌 발생량과 관련 된 대립유 전자(favorable alleles(FA))로 밝혀져 있다(5). ACS1-2/2, ACO1-1/1로 FA 4인 품종은 전체의 10.7%로 ‘Yeohong’, ‘Danhong’, ‘Hwayoung’으로 확인되었다. ACS1-2/2, ACO1-1/2 로 FA 3인 품종은 전체의 53.6%로 ‘Hongro', 'Arisoo', 'RubyS' 등 가장 많은 품종이 해당되었다. ACS1-1/2, ACO1-1/2로 FA 2인 품종은 ‘Summer King', 'Greenball' 등 28.6%였고, ACS1-1/1, ACO1-1/2로 FA 1인 품종은 7.1%로 ‘Rosebell’, ‘Summerprince’로 확인되었다. 저장성이 강한 것으로 알려진 ‘Fuji’는 ACS1-2/2, ACO1-1/1로 FA 4인 것으 로 확인 되었으며(Fig. 1), Zhu와 Barritt(17)이 보고한 연구 결과와 같았다. ‘Danhong’과 ‘Hwayoung’은 ‘Fuji’의 아조변 이 품종으로 각각 단과지, 조기 착색과 관련 된 변이지에서 선발되었기 때문에 ‘Fuji’와 같은 대립유전자형을 가지는 것으로 판단된다. ‘Golden Supreme'은 ACS1-1/1, ACO1-1/2 로 FA 1인 것으로 확인되었다(Fig. 1).

Table 2. The fruit characteristics and Md-ACS1, Md-ACO1 genotype of 28 Korean apples
Cultivar Year released Fruit shape Fruit skin color Harvest time1) Acidity2) Sweetness 3) Fruit weight4) Genoytpe No. favorable alleles (FA)5)
ACS1 ACO1
Hongro 1988 Globose-conical Red 2 1 5 3 2/2 1/2 3
Chukwang 1992 Flat-globose Red 2 1 3 4 2/2 1/2 3
Gamhong 1992 Oblong Red 3 3 5 4 2/2 1/2 3
Hwahong 1992 Globose Red 3 1 3 3 1/2 1/2 3
Seokwang 1995 Globose Red 1 4 2 3 2/2 1/2 3
Saenara 1997 Conical Red 2 4 3 3 2/2 1/2 3
Sunhong 2000 Conical Light-red 1 2 3 4 2/2 1/2 3
Honggeum 2004 Oblong Light-red 2 3 4 3 2/2 1/2 3
Seohong 2004 Globose Light-red 1 3 3 2 2/2 1/2 3
Summer-dream 2005 Flat-globose Light-red 1 2 3 2 1/2 1/2 2
Manbok 2006 Flat- Dark-red 1 2 3 2 1/2 1/2 2
Hongso 2006 Globose-conical Light-red 2 3 4 2 1/2 1/2 2
Hongan 2006 Globose Red 2 1 3 2 2/2 1/2 3
Yeohong 2007 Globose Red 3 5 4 4 2/2 1/1 4
Danhong 2008 Oblong Red 3 3 4 3 2/2 1/1 4
Picnic 2008 Globose-conical Red 2 4 5 2 2/2 1/2 3
Greenball 2008 Oblong- Yellow-green 1 3 3 4 1/2 1/2 2
Hwasa 2009 Globose-conical Light-red 3 3 3 3 2/2 1/2 4
Hwangok 2009 Globose-conical Yellow 2 5 5 2 2/2 1/2 3
Hwayoung 2008 Oblong Red 3 3 4 2 2/2 1/1 3
Summer King 2010 Globose-conical Light-red 1 4 3 3 1/2 1/2 2
Arisoo 2010 Globose Light-red 2 3 4 3 2/2 1/2 3
Goldenbell 2011 Globose Yellow 2 5 0 1 1/2 1/2 2
Rosebell 2011 Globose Yellow 1 5 0 1 1/1 1/2 1
Tinkerbell 2012 Globose Dark-red 1 5 1 1 1/2 1/2 2
Decobell 2013 Oblong Red 2 5 1 1 1/2 1/2 2
Summer-prince 2014 Globose-conical Light-red 1 4 2 3 1/1 1/2 1
RubyS 2014 Globose Red 1 4 3 1 2/2 1/2 3

1) Harvest time: 1=from July to September, 2=September, 3=October.

2) Acidity: 0=No acidity, 1=Week, 2=Midium-week, 3=Midium, 4=Midium-strong, 5=strong.

3) Sweetness: 0=Not sweet, 1=Week, 2=Midium-week, 3=Midium, 4=Midium-strong, 5=strong.

4) Fruit weight: 1= <100 g, 2=150-250 g, 3=250-300 g, 4= >300 g.

5) Mean to add up number of the alleles (ACS1-2, ACO1-1) of low ethylene production.

Download Excel Table
kjfp-24-7-891-g1
Fig. 1. Md-ACS1 and Md-ACO1 banding patterns for the seven apple cultivars. The top panel shows Md-ACS1 allelic forms. The bottom panel shows Md-ACO1 allelic forms: ‘Fuji' (lane 1), ’RubyS' (lane 2), ‘Hongro' (lane 3), ’Arisoo' (lane 4), ‘Summer King' (lane 5), ’Greenball' (lane 6), ‘Golden Supreme' (lane 7); 1 Kb DNA ladder (M).
Download Original Figure
Md-ACS1와 Md-ACO1 유전자형에 따른 에틸렌 발생량

수확일로부터 상온저장(20℃) 25일간 조사 된 에틸렌 발 생량은 품종별로 큰 차이를 보였으나, 낮은 에틸렌 발생량 과 관련 된 대립유전자 ACS1-2, ACO1-1이 많을수록 에틸렌 발생량도 낮은 경향을 보였다(Fig. 2). 가장 낮은 에틸렌 발생량을 보인 ‘RubyS’(ACS1-2/2, ACO1-1/2, FA 3)를 제외 하면, ‘Fuji’(ACS1-2/2, ACO1-1/1, FA 4), ‘Hongro’ (ACS1-2/2, ACO1-1/2, FA 3), ‘Arisoo’(ACS1-2/2, ACO1-1/2, FA 3), ‘Summer King’(ACS1-1/2, ACO1-1/2, FA 2), ‘Greenball’ (ACS1-1/2, ACO1-1/2, FA 2), ‘Golden Supreme’(ACS1-1/1, ACO1-1/2, FA 1) 순으로 에틸렌 발생량이 낮은 것으로 조사 되었다. 평균 과중 80-90 g인 소과종 ‘RubyS'는 에틸렌 발생 량이 0.1-0.2 μL·L-1·h-1 으로 매우 낮은 수치를 보였는데, 이 결과를 설명하기 위해서는 다른 소과종과의 비교 실험이 필요할 것으로 생각된다.

kjfp-24-7-891-g2
Fig. 2. Change ethylene production in the seven apple cultivars over 25 days after harvest at room temperature (20℃). Bars represent±SD (n=15).
Download Original Figure

‘Golden Supreme'의 에틸렌 발생은 다른 품종들에 비해 매우 높았으며, 저장 9일에 45.4 μL·L-1·h-1 으로 가장 높은 수치를 보였다가 빠르게 감소하였다. 'Golden Supreme' 다 음으로 높은 에틸렌 발생량을 보인 ‘Greenball'은 저장 16일 에 18.1 μL·L-1·h-1 으로 가장 높은 발생량을 보였다. 'Summer King'은 같은 유전자형을 가진 ‘Greenball' 보다는 낮은 에틸렌 발생량을 보였으며 저장 19일에 5.5 μL·L-1·h-1 으로 가장 높은 발생량을 보였다. 'Arisoo'는 저장 10일까지 ‘Hongro', ‘Fuji'와 에틸렌 발생량이 비슷한 수치였으나 그 이후부터 조금 더 높아졌으며, ‘Hongro'의 에틸렌 발생량은 ‘Arisoo’ 보다는 낮지만 ‘Fuji'와는 비슷하거나 조금 높았다. ‘Arisoo'는 저장 22일에 2.4 μL·L-1·h-1, 'Hongro'는 저장 25 일에 1.2 μL·L-1·h-1, ‘Fuji'는 저장 25일에 1.0 μL·L-1·h-1으로 가장 높은 발생량을 보였다. ‘Fuji'는 다른 품종들에 비해 에틸렌 발생량이 낮고 저장성이 좋다고 보고되어 있다 (5,18). 본 실험에서도 'RubyS'를 제외한 다른 품종들 보다 낮은 에틸렌 발생량을 확인할 수 있었다. ‘Fuji'의 에틸렌 발생이 낮은 것은 ACS1-2/2 promoter region의 SINE retroposon insertion에 의한 것으로 밝혀져 있는데(17), ‘Fuji'와 비슷한 발생 양상을 보인 ‘Hongro'와 더 낮은 발생 량을 보인 ’RubyS'도 이와 같은 변이에 대한 확인이 필요할 것으로 생각된다.

ACO1 대립유전자형이 ACO1-1/2로 동일한 품종들의 ACS1 대립유전자형에 따른 에틸렌 발생량은 ACS1-1/1인 ‘Golden Supreme’이 가장 높았으며, ACS1-2/2인 ‘RubyS’, ‘Hongro’, ‘Arisoo’는 다른 대립유전자형을 가진 품종들에 비해 낮은 에틸렌 발생량을 보였다. ‘Golden Delicious’ (ACS1-1/2)와 ‘Braeburn’(ACS1-1/2)의 교배실생들의 에틸 렌 발생량은 ACS1-2/2이 가장 낮았으며 ACS1-1/1은 가장 높았고, ACS1-1/2는 중간이었다고 보고한 Costa 등(19)의 결과와 유사하였다. 또한 ACS1-2/2는 ACS1-2/2와 ACO1-1/1 의 유전자형을 가지는 품종들 보다 내생에틸렌 발생량이 낮았으며, ACS1 mRNA의 발현양이 다른 품종들에 비해 적었음이 보고 된 바 있다(20).

상온저장 후 경도 연화율

수확일의 경도는 품종 특성에 따라 다른 것으로 확인되 었으나 상온저장 20일 후 경도 연화율은 에틸렌 발생 양상 과 비슷한 경향을 보였다(Table 3). 에틸렌 발생량이 가장 높았던 ‘Golden Supreme’은 경도 연화율이 가장 높았다. 에틸렌 발생량이 가장 낮았던 ‘RubyS’의 경도 연화율은 가장 낮았고, 다음으로 경도 연화율이 낮은 품종은 ‘Fuji’, ‘Hongro’, ‘Arisoo’, ‘Greenball’, ‘Summer King’의 순이었다. ‘Greenball’은 에틸렌 발생량이 ‘Summer King’ 보다 높았지 만 경도 연화율은 조금 낮은 것으로 확인되었다.

Table 3. Fresh fruit firmness at harvest, firmness after 20 days of room temperature (20℃) storage and softening rate (difference between firmness at harvest and firmness after storage, divided by number of storage days) in the seven apple cultivars
Cultivars Firmness (Newton/11 mm plunger) Softening rate
Harvest time after storage
Fuji 68.52±0.391)a2) 61.03±0.25ab 0.37a
RubyS 71.00±0.35a 68.43±0.38a 0.13a
Hongro 71.14±0.72a 55.98±0.63b 0.76ab
Arisoo 74.93±0.33a 58.30±0.71ab 0.83ab
Summer King 70.38±0.24a 47.46±0.28b 1.15b
Greenball 57.07±0.37b 34.42±0.10b 1.13b
Golden Supreme 70.38±0.24a 44.93±0.17c 1.27c

1) Values are means±SD (n=9).

2) Means followed by the same letters within the column per parameter are not significantly different (p<0.05).

Download Excel Table

Oraguzie 등(21)은 저장기간 중 경도 연화율이 ACS1-2/2 인 만생종인 경우 가장 낮았고, ACS1-1/1인 조생종의 경우 가장 높았다고 보고하였는데, ACS1-1/1인 조생종 ‘Golden Supreme’의 경도 연화율이 가장 높았고, ‘RubyS’를 제외하 고 ACS1-2/2인 만생종 ‘Fuji’가 가장 낮았던 것으로 조사 된 본 실험의 결과와 유사하였다. 따라서, 국내육성품종들 의 숙기와 ACS1, ACO1 유전자형에 따른 에틸렌 발생, 경도 등 저장성 특성을 검토해 볼 필요성이 있을 것으로 생각된 다.

Zhu와 Brritt(17)은 수확일 및 저온저장 60일 후 경도는 ACS1-2/2인 경우에 ACS1-1/2, ACS1-1/1 보다 높았고, ACO1-1/1인 경우 ACO1-1/2, ACO1-2/2 보다 높았으나, 경 도 연화율에 있어서는 ACS1 및 ACO1 대립유전자형과의 밀접한 관계를 찾을 수 없었다고 하여 본 실험의 결과와는 조금 달랐다. 그러나, Md-ACS1 및 Md-ACO1 분자표지를 이용하여 교배조합 작성 및 교배실생 조기선발을 통한 저장 성이 강한 사과 육종이 가능 할 것이라고 보고하였다.

과거에 개발 된 사과 품종들의 ACS1-2/2 빈도는 20% 미만에 불과하였으나 과실 품질을 개량하기 위한 현대의 사과 육종 프로그램이 적용 된 최근에 등록 된 품종은 50% 이상의 높은 비율을 차지한다는 분석 결과가 보고된 바 있다(22). 이것은 사과의 품질 중 저장성 형질이 아주 중요 한 육종 목표이며, 저장성 형질과 관련 된 Md-ACS1와 Md-ACO1 분자표지의 검증 및 활용은 육종효율 향상을 위 한 MAS에 꼭 필요하다는 의미가 될 것이다. 본 실험의 결과, 수확 후 저장기간 동안의 에틸렌 발생 및 경도 연화율 은 Md-ACS1 및 Md-ACO1 대립유전자형과 상관성이 있는 것으로 확인되었다. 따라서 사과의 저장성 형질과 관련 된 Md-ACS1 및 Md-ACO1 분자표지를 이용한 간단한 PCR 분 석을 통해 사과 국내육성품종의 저장성 예측 및 육종 효율 향상을 위한 교배조합 작성, 교배실생의 조기선발이 가능 할 것으로 생각 된다.

요 약

사과는 에틸렌에 의해 호흡량이 일시적으로 상승하는 호흡급등형 과실이다. 에틸렌 발생은 세포벽분해효소 활성 화와 세포벽 연화를 진행시켜 사과의 상품성과 저장성을 떨어뜨리는 원인이 된다. 사과의 에틸렌 생합성 과정에는 Md-ACS1 및 Md-ACO1 유전자가 연관되어 있으며, 두 유전 자는 과실의 에틸렌 발생량과 경도에 영향을 미치는 것으로 알려져 있다. 본 연구는 사과 국내육성 28품종의 Md-ACS1 및 Md-ACO1 대립유전자형을 분석하고, ‘Fuji(FJ)', ‘RubyS (RS)', ‘Hongro(HR)', ‘Arisoo(AS)', ‘Summer King(SK)', ‘Greenball(GB)', ‘Golden Supreme(GS)'을 대상으로 수확 후 25일까지의 에틸렌 발생량 및 상온저장(20℃) 20일 동안 의 경도 연화율을 조사하였다. 그 결과, 낮은 에틸렌 발생량 과 관련 된 대립유전자(favorable alleles0(FA)) ACS1-2, ACO1-1이 많을수록 에틸렌 발생량과 경도 연화율이 낮은 경향을 보였다. GS은 ACS1-1/1, ACO1-1/2(FA 1)으로 모든 품종 중 가장 높은 에틸렌 발생 수치와 경도 연화율를 보였 다. SK와 GB은 ACS1-1/2, ACO1-1/2(FA 2)으로 ACS1-2/2, ACO1-1/2(FA 3)인 HR와 AS 보다는 높고 GS 보다 낮은 에틸렌 발생량과 경도 연화율을 보였다. ACS1-2/2, ACO1-1/1(FA 4)인 FJ는 RS를 제외한 모든 품종 중에 에틸 렌 발생량과 경도 연화율이 가장 낮았다. 본 실험의 결과 Md-ACS1 및 Md-ACO1 대립유전자형과 사과의 에틸렌 발 생량 및 경도 연화율은 상관성이 있는 것으로 확인되었다. 따라서, Md-ACS1 및 Md-ACO1 분자표지를 사과 국내육성 품종의 저장성 예측과 육종 효율 향상을 위한 Markerassisted selection에 활용할 수 있을 것으로 생각 된다.

감사의 글

본 연구는 2017년도 농촌진흥청 국립원예특작과학원 기 관고유사업(과제번호: PJ011220)의 지원에 의해 수행되었 습니다.

References

1.

Ahn YJ, Choi JS, Min BH, Yi KU. Effect of ethylene adsorbent on apple fruit quality during storage.. J Natural sci Paichai Univ. 1996; 8:169-173.

2.

Taiz L., Zeiger E. Plant Physiology. Soeul, Korea: Life Science publishing co. 2013; p. 622-625.

3.

Li T., Tan D., Yang X., Wang A. Exploring the apple genome reveals six ACC synthase genes expressed during fruit ripening.. Sci. Hortic. (Amsterdam). 2013; 157:119-123

4.

Wakasa Y., Kudo H., Ishikawa R., Akada S., Senda M., Niizeki M., Harada T. Low expression of an endopolygalacturonase gene in apple fruit with long-term storage potential.. Postharvest Biol. Technol. 2006; 39:193-198

5.

Costa F., Stella S., Van de Weg W.E., Guerra W., Cecchinel M., Dallivina J., Koller B., Sansavini S. Role of the genes Md-ACO1 and Md-ACS1 in ethylene production and shelf life of apple (Malus domestica Borkh).. Euphytica. 2005; 141:181-190

6.

Yang X., Song J., Campbell-Palmer L., Fillmore S., Zhang Z. Effect of ethylene and 1-MCP on expression of genes involved in ethylene biosynthesis and perception during ripening of apple fruit.. Postharvest Biol. Technol. 2013; 78:55-66

7.

Johnston J.W., Hewett E.W., Hertog M.L., Harker F.R. Temperature induces differential softening responses in apple cultivars.. Postharvest Biol. Technol. 2001; 23:185-196

8.

Park J.Y., Kim K.O., Yoo J.G., Win N.M., Lee J.W., Choung M.G., Jung H.Y., Kan I.K. Effects of aminoethoxyvinylglycine (AVG) and 1-methylcyclopropene (1-MCP) treatments on fruit quality attributes in cold-stored ‘Jonathan’ apples.. Korean J Food Preserv. 2016; 23:453-458.

9.

Yoo J.G., Kang B.K., Lee J.W., Kim D.H., Lee D.H., Jung H.Y., Choi D.G., Choung M.G., Choi I.M., Kang I.K. Effect of preharvest and postharvest 1-methylcyclopropene (1-MCP) treatments on fruit quality attributes in cold-stored ‘Fuji’ apples.. Kor J Hort Sci Technol. 2015; 33:542-549

10.

Yoo J.G., Kim D.H., Lee J.W., Choi D.G., Han J.S., Kwon S.I., Kweon H.J., Kang I.K. Effect of preharvest sprayable 1-methylcyclopropene (1-MCP) treatment on fruit quality attributes in cold stored ‘Gamhong’ apples.. Protected Hortic Plant Factory. 2013; 22:279-283

11.

Choi S.J. Comparison of the change in quality and ethylene production between apple and peach fruits treated with 1-methylcyclopropene (1-MCP).. Kor J Food Preserv. 2005; 12:511-515.

12.

Watkins C.B. Overview of 1-methylcyclopropene trials and uses for edible horticultural crops.. HortScience. 2008; 43:86-94.

13.

Johnston J.W., Hewett E.W., Hertog M.L. Postharvest softening of apple (Malus domestica) fruit: A Review.. N. Z. J. Crop Hortic. Sci. 2002; 30:145-160

14.

Nybom H., Ahmadi-Afzadi M., Sehic J., Hertog M. DNA marker-assisted evaluation of fruit firmness at harvest and post-harvest fruit softening in a diverse apple germplasm.. Tree Genet. Genomes. 2013; 9:279-290

15.

Zhu Y., Mattheis J., Barritt B., Peace C. Funtional genomics and marker development for apple sensory qualities. Final Report of USDA.. ARS (SA o Paulo). 2009.

16.

Sunako T., Sakuraba W., Senda M., Akada S., Ishikawa R., Niizeki M., Harada T. An allele of the ripening-specific 1-aminocyclopropane-1-carboxylic acid synthase gene (ACS1) in apple fruit with a long storage life.. Plant Physiol. 1999; 119:1297-1303

17.

Zhu Y., Barritt B.H. Md-ACS1 and Md-ACO1 genotyping of apple (MalusA-domestica Borkh.) breeding parents and suitability for marker-assisted selection.. Tree Genet. Genomes. 2008; 4:555-562

18.

Kondo S., Uthaibutra J., Gemma H. Comparison of 1-aminocyclopropane-1-carboxylic acid, abscisic acid and anthocyanin content of some apple cultivars during fruit growth and maturation.. J. Jpn. Soc. Hortic. Sci. 1991; 60:505-511

19.

Costa F., Cappellin L., Farneti B., Tadiello A., Romano A., Soukoulis C., Sansavini S., Velasco R., Biasioli F. Advances in QTL mapping for ethylene production in apple (MalusA-domestica Borkh.).. Postharvest Biol. Technol. 2014; 87:126-132

20.

Harada T., Sunako T., Wakasa Y., Soejima J., Satoh T., Niizeki M. An allele of the 1-aminocyclopropane- 1-carboxylate synthase gene (Md-ACS1) accounts for the low level of ethylene production in climacteric fruits of some apple cultivars.. Theor. Appl. Genet. 2000; 101:742-746.

21.

Oraguzie N.C., Iwanami H., Soejima J., Harada T., Hall A. Inheritance of the Md-ACS1 gene and its relationship to fruit softening in apple (Malus domestica Borkh.).. Theor. Appl. Genet. 2004; 108:1526-1533.

22.

Nybom H., Sehic J., Garkava-Gustavsson L. Modern apple breeding is associated with a significant change in allelic ratio of the ethylene production gene Md-ACS1.. J. Hortic. Sci. Biotechnol. 2008; 83:673-677.

Transition to Article Processing Charges (APCs)


Please be advised that, effective January 1, 2027, Food Science and Preservation (FSP) will transition from the current publication charge system to an Article Processing Charge (APC) system.

The APCs will be applied as follows:

  • Korean-language manuscripts: KRW 600,000 per manuscript
  • English-language manuscripts: KRW 300,000 per manuscript
  • Manuscripts submitted by authors outside Korea: USD 300 per manuscript
  • Fast-track manuscripts: An additional expedited review fee of KRW 300,000 (USD 300 for manuscripts submitted by authors outside Korea)
  • Invited English-language review articles: Exempt from all APCs

The new APC policy will apply to manuscripts submitted on or after January 1, 2027. Manuscripts submitted by December 31, 2026 will remain subject to the current publication charge policy.

For further details, please refer to the Article Processing Charges (APCs) Guidelines.

Thank you for your understanding and cooperation.

Food Science and Preservation (FSP)


I don't want to open this window for a day.

Call for Papers: FSP 2026 Special Topic



I don't want to open this window for a day.