Research Article

스마트팜 재배 땅콩새싹 추출물의 피부 보습, 장벽 강화 및 재생 효과

박찬미https://orcid.org/0000-0001-6813-533X, 박송은https://orcid.org/0009-0008-8876-3315, 차건수https://orcid.org/0000-0003-0598-3133, 김지효https://orcid.org/0009-0009-5750-2494, 소양강*https://orcid.org/0009-0004-9992-8008
Chan Mi Parkhttps://orcid.org/0000-0001-6813-533X, Song Eun Parkhttps://orcid.org/0009-0008-8876-3315, Gun Su Chahttps://orcid.org/0000-0003-0598-3133, Jihyo Kimhttps://orcid.org/0009-0009-5750-2494, Yangkang So*https://orcid.org/0009-0004-9992-8008
Author Information & Copyright
1(재)남원시바이오산업연구원
1Institute of Natural Bio Industry for Namwon, Namwon 55801, Korea
*Corresponding author Yangkang So Tel: +82-63-633-8603 E-mail: yangkang@nbn.re.kr

These authors contributed equally to this study.

Citation: Park CM, Park SE, Cha GS, Kim J, So Y. Skin moisturizing, barrier-enhancing, and regenerative effects of smart farm-cultivated peanut sprout extracts. Food Sci. Preserv., 32(6), 1200-1209 (2025)

Copyright © The Korean Society of Food Preservation. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Oct 02, 2025; Revised: Nov 05, 2025; Accepted: Nov 07, 2025

Published Online: Dec 30, 2025

Abstract

Peanut sprouts, derived from germinating peanuts (Arachis hypogaea L.), are rich in bioactive compounds with health-promoting effects, including antioxidant, anti-inflammatory, and anti-obesity activities. In this study, peanut sprouts were cultivated in a smart farm, and extracts were prepared using water, 50% ethanol, and absolute ethanol to assess their phytochemical contents and skin-beneficial properties. The absolute ethanol extract exhibited the highest total polyphenol and flavonoid contents (78.06 mg/g and 6.54 mg/g, respectively), while LC-MS/MS analysis revealed that the 50% ethanol extract contained the highest levels of resveratrol (4.71 μg/g) and polydatin (3.14 μg/g). All extracts were non-cytotoxic to HaCaT cells. The 50% and absolute ethanol extracts upregulated hyaluronic acid synthase-2 (HAS-2), while HAS-3 expression remained unaffected. They also increased filaggrin and involucrin expression, indicating enhanced skin moisturization and barrier function. Moreover, these extracts significantly accelerated wound closure, demonstrating potent skin-regenerative effects. Therefore, these findings suggest that peanut sprout extracts are promising candidates for functional cosmetic applications.

Keywords: peanut sprout; smart farm; skin moisturization; skin barrier; skin regeneration

1. 서론

땅콩(Arachis hypogaea L.)은 콩과(Leguminosae)에 속하는 작물로, 단백질, 지방, 식이섬유가 풍부하며, 약 40%의 지방, 25%의 단백질, 10%의 탄수화물을 함유하고 있다. 또한 레시틴, 비타민(A, B, E, K), 칼슘, 인, 철 등 다양한 무기질과 인체에 필요한 필수 아미노산을 포함하고 있어 영양학적으로 가치가 높은 식품으로 알려져 있다. 더불어 isoflavones, phenolic acids, stilbenes 등의 파이토케미컬을 함유하고 있으며, 항산화, 항염, 항암 등의 건강 증진 효과가 보고되고 있다(Arya 등, 2016). 땅콩새싹은 땅콩에 싹을 틔운 형태로 약 33%의 지방, 35%의 단백질, 21%의 탄수화물을 함유하고 있으며, 발아에 따라 지방은 감소하고 resveratrol, gamma-aminobutyric acid(GABA) 및 aspartic acid 등의 함량이 증가한다고 보고되었다(Hung과 Chen, 2022; Lee 등, 2024; Wang 등, 2005). 땅콩새싹 추출물은 항비만, 혈중 지질 개선, 인지기능 개선 등의 효능이 보고되어 기능성 식품 소재로서의 활용 가능성이 제시되고 있다(Ha 등, 2015; Lee와 Choi, 2021; Park 등, 2022). 또한, 땅콩새싹 추출물은 세포 수준에서 높은 항산화, 항염 및 미백 개선 효능이 보고 되어 기능성 화장품 소재로서의 활용 가능성이 높은 것으로 알려져 있다(Choi 등, 2013; Choi 등, 2015; Yoon, 2016). 이러한 특성으로 미루어 볼 때, 땅콩새싹 추출물이 피부 보습, 장벽 강화 및 재생에도 효과를 나타낼 것으로 기대된다.

피부는 인체를 외부 환경으로부터 보호하는 가장 큰 기관으로 신체의 항상성 유지에 중요한 역할을 한다. 피부의 가장 바깥층인 각질층은 각질세포와 세포 간 지질로 구성되며, 외부 유해 물질의 침투를 차단하고 체내 수분의 손실을 방지하는 피부 장벽 기능을 한다. 피부 장벽의 손상은 외부 자극 물질과 병원균의 침투가 증가하여 가려움증, 건성피부, 접촉피부염, 세균성 감염, 아토피피부염 등 다양한 피부질환을 일으킨다(Baker 등, 2023; Proksch 등, 2008; Rajkumar 등, 2023). 피부 장벽의 항상성은 각질세포의 분화 과정과 밀접하게 연관되어 있으며, 이 과정에서 발현되는 다양한 단백질이 장벽 기능의 형성과 유지에 중요한 역할을 한다. 그중 filaggrin과 involucrin은 각질세포 분화의 후기에 발현되는 구조 단백질로, filaggrin은 케라틴 섬유와 결합하여 각질세포의 형태를 유지하고 분해 산물이 천연 보습 인자를 형성하여 피부 보습에 관여한다. Involucrin은 세포막 내부에서 loricrin 등과 같은 단백질 및 지질층과 결합하여 각질세포 외피를 형성하고 피부 장벽의 투과 차단 기능을 강화한다(Candi 등, 2005; Robinson 등, 1996; Sandilands 등, 2009). 또한, hyaluronic acid synthase(HAS)는 히알루론산(hyaluronic acid, HA)을 합성하여 세포외기질 내 수분을 유지하고, 세포 이동 및 재생을 촉진함으로써 피부의 보습과 조직 회복에 기여한다(Huang 등, 2018; Kobayashi 등, 2020). 따라서, 이러한 단백질의 발현은 피부의 보습, 장벽 강화 및 재생에 중요한 기전으로 작용하며, 이를 조절할 수 있는 바이오소재의 개발은 피부의 기능을 향상시키는 화장품 소재로 활용 가능성을 시사한다.

최근 농업 분야에서는 기후변화, 노동력 부족, 고품질 원료에 대한 수요 증가에 대응하기 위해 환경제어농업(controlled environment agriculture, CEA) 기반의 스마트팜(smart farm) 기술이 도입되고 있다(Engler와 Krarti, 2021). 정보통신기술과 융합된 스마트팜은 IoT 센서를 통한 농작물 생육 환경을 모니터링하고 온도, 습도, 조도, 광주기 등의 재배 환경을 정밀하게 제어함으로써 안정적이고 균일한 작물 재배를 가능하게 한다. 스마트팜에서 생성된 환경 및 생육 데이터는 환경 및 작물 생육 예측 모델 제작과 스마트팜 기술 고도화를 위한 연구에 활용할 수 있다(Akkem 등, 2023; Choi, 2021; Durai와 Shamili, 2022). 또한, 스마트팜의 환경제어 기술은 균일한 작물 생산에 기여할 뿐만 아니라 작물의 기능성 성분의 함량을 증진시킬 수 있는 수단으로 주목받고 있다. 최근 연구에 따르면, LED 광질 조절을 통해 작물의 무기질 함량 증가, 2차 대사산물 축적 및 생장 촉진 효과가 확인되었다(Heo와 Baek, 2021; Nguyen 등, 2019; Zhu 등, 2020). 이러한 연구 결과들은 스마트팜이 단순한 작물 생산량 증대를 넘어, 기능성 성분을 고도화할 수 있는 플랫폼으로 활용될 수 있음을 시사한다. 본 연구에서는 스마트팜에서 재배된 땅콩새싹의 생리활성 성분인 resveratrol과 polydatin의 함량을 분석하고, 기존에 보고되지 않은 땅콩새싹 추출물의 피부 보습, 장벽 강화 및 재생 효능을 평가함으로써 기능성 화장품 소재로서의 응용 가능성을 검토하였다.

2. 재료 및 방법

2.1. 시약 및 재료

Folin-Ciocalteu’s phenol reagent, tannic acid, kaempferol, resveratrol, polydatin 및 ethanol은 Sigma-Aldrich(St. Louis, MO, USA)에서 구입하였다. Liquid chromatography-mass spectrometry(LC-MS) grade water와 acetonitrile은 Thermo Fisher Scientific Inc.(Waltham, MA, USA)에서 구입하여 사용하였다.

2.2. 땅콩새싹 재배

땅콩새싹은 2023년 10월에 수확한 신팔광 품종의 땅콩(A. hypogaea L.)을 이용하여 재배하였다. 종자 중량 대비 10배수의 물에 24시간 동안 상온(25±1°C)에서 침지한 뒤 불림 처리된 종자 400 g을 재배판(600×300 mm, 무배지 조건)에 균일하게 파종하였다. 파종 직후부터 재배판 상부 약 1 m 높이에 설치된 분무 노즐을 이용해 전 생육기간 동안 2시간 간격으로 10분씩 물을 분무하였다. 양액은 물푸레 1호 A와 1호 B(DAEYU, Seoul, Korea)를 1:1(v/v)로 혼합하여 1일 1회 분무 시스템을 통해 공급하였다. 파종 후 4일간 암조건에서 발아를 유도하였으며, 이후 생육실 환경은 온도 25±1°C, 상대습도 60-70%로 유지하였다. 광원은 올릭스(Jeonju, Korea)에서 제작한 LED 모듈(ALPG-1500(40), 정격 40 W, AC 150-250 V·50-60 Hz, 광속 4,150 lm, 광효율 105 lm/W, CCT 3,000-5,000 K, CRI ≥ 93, IP65, 배광각 120°±10)을 사용하였다. 광도는 최대 PPFD 48 μmol/m2/sec의 약 66% 수준으로 조절하여 약 32 μmol/m2/sec로 조사하였다. 광주기는 발아 유도 이후 생육기간 동안 점등 1시간-소등 1시간 주기로 설정하였다. 땅콩 새싹은 파종 12일 후에 수확하여 전체 식물체를 성분 분석에 사용하였다.

2.3. 땅콩새싹 추출물 제조

건조된 땅콩새싹 35 g에 700 mL의 3차 증류수, 50% ethanol, absolute ethanol을 각각 가한 후 가열 교반 맨틀(MS-EAMDSD, Misung Scientific Co. Ltd., Seoul, Korea)을 사용하여 환류 추출하였다. 각 추출물은 여과지(Cytiva, Marlborough, MA, USA)를 사용하여 감압 여과하였으며 회전 감압 농축기(60°C, N-1200B, Eyela, Bohemia, NY, USA)로 농축하였다. 이후 동결건조기(MCFD 8508, Ilshin Biobase Co. Ltd., Seoul, Korea)로 건조한 시료를 실험에 사용하였다.

2.4. 총폴리페놀 함량 측정

땅콩새싹 추출물의 총폴리페놀 함량(total polyphenol content, TPC)은 Folin-Ciocalteau법을 변형하여 측정하였다(Velioglu 등, 1998). 각 추출물의 농도를 1 mg/mL로 제조한 후 추출물 시료 80 μL에 Folin-Ciocalteau’s phenol reagent 20 μL를 넣고 빛을 차단한 상온에서 5분간 반응시켰다. 2% sodium carbonate (w/v) 100 μL를 위 반응액에 첨가하고 상온에서 30분간 반응시킨 뒤 multimode microplate reader(SPARK, TECAN, Seestrasees, Switzerland)를 이용하여 750 nm에서 흡광도를 측정하였다. 각 추출물의 TPC는 tannic acid를 표준물질로 이용한 검량선과 비교하여 산출하였다.

2.5. 총플라보노이드 함량 측정

땅콩새싹 추출물의 총플라보노이드 함량(total flavonoid content, TFC)은 Lee 등(1997)의 방법을 변형하여 측정하였다. 각 추출물의 농도를 10 mg/mL로 제조한 후 추출물 시료 10 μL, diethylene glycol 100 μL, 1N NaOH 10 μL를 혼합하였다. 상온에서 1시간 동안 반응시킨 후 multimode microplate reader(SPARK, TECAN)를 이용하여 420 nm에서 흡광도를 측정하였다. 각 추출물의 TFC는 kaempferol을 표준물질로 이용한 검량선과 비교하여 산출하였다.

2.6. LC-MS/MS를 이용한 성분 분석

땅콩새싹 추출물의 resveratrol과 polydatin 함량을 분석하기 위해 ACQUITY UPLC®system(Waters, Milford, MA, USA)과 XEVO TQ-S micro MS/MS system(Waters, Milford, MA, USA)이 결합된 liquid chromatography-tandem mass spectrometry (LC-MS/MS)를 사용하였다. 땅콩새싹 추출물 시료(3 μL)를 autosampler를 이용하여 C18 column(ACQUITY UPLC®BEH C18 1.7 μm, 2.1 mm×50 mm, Waters)에 주입하였으며, column oven은 35°C로 유지하였다. Electro Spray Ionization (ESI)를 이용하여 음이온 모드에서 분석하였고, 이동상으로는 0.1% formic acid를 함유한 water(A)와 0.1% formic acid를 함유한 acetonitrile(B)을 사용하였다. 이동상 기울기는 (B)를 기준으로 0-5.5 min: 15%, 5.5-9 min: 15-90%, 9-10 min: 90%, 10-12 min: 15%로 분석하였다. 각 추출물의 resveratrol과 polydatin의 정량분석은 multiple reaction monitoring(MRM) 모드에서 수행되었으며, 표준물질의 검량선과 비교하여 산출하였다. 표준물질의 MRM 전이 및 전하 상태와 XEVO TQ-S micro MS/MS system의 cone voltage 및 collision energy는 Table 1에 나타내었다.

Table 1. Compound specific liquid chromatography-tandem mass spectrometry (LC-MS/MS) parameters of resveratrol and polydatin
Charge state Precursor ion (m/z) Product ion (m/z) Cone voltage (V) Collision energy (eV)
Resveratrol −1 227 142.9 50 28
184.9 50 18
Polydatin −1 435 184.9 15 45
226.9 15 25
Download Excel Table
2.7. 세포배양

실험에 사용된 사람 각질형성세포(human keratinocyte, HaCaT)는 서울아산병원(Seoul, Korea)으로부터 분양받았다. 세포배양을 위한 배지는 10% fetal bovine serum(Gibco Life Technologies, Waltham, MA, USA)와 1% penicillin-streptomycin(Hyclone, Marlborough, MA, USA)를 포함한 Dulbescco’s modified Eagle’s media(DMEM; Gibco Life Technologies)를 사용하였다. HaCaT 세포는 5% CO2, 37°C 조건의 CO2 인큐베이터(BB 150 CO2 Incubator, Thermo Fisher Scientific Inc., Waltham, MA, USA)에서 배양하였다.

2.8. 세포 독성 평가

땅콩새싹 추출물의 HaCaT 세포에 대한 독성을 평가하기 위해 세포 생존율을 측정하였다(Tominaga 등, 1999). HaCaT 세포(4×104 cells/well)를 48-well plate에 분주하고 24시간 동안 배양하여 부착시킨 후, 각 추출물을 농도별로 처리하고 24시간 동안 배양하였다. Cell Counting Kit-8(CCK-8; Dojindo Laboratories, Kumamoto, Japan)를 각 well에 첨가하고 세포 배양기에서 1시간 동안 반응시킨 후 multimode microplate reader (SPARK, TECAN)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존율(%)은 다음식으로 계산하였으며, 세포 생존율이 90% 미만일 경우 시료가 독성을 나타낸다고 평가하였다.

Cell viability (%) =  A sample A blank / A control A blank × 100
2.9. 유전자 발현 분석

HaCaT 세포(8×105 cells/well)를 6-well plate에 분주한 후 24시간 동안 배양하여 부착시켰다. 이후 serum-free 배지로 교환한 후 각 추출물을 100 μg/mL 농도로 처리하고 48시간 동안 추가 배양하였다. 총 RNA는 Trizol reagent(Invitrogen, Waltham, MA, USA)를 이용하여 추출하였으며, RNA to cDNA EcoDry Premix(TaKaRa, Kyoto, Japan)를 사용하여 cDNA를 합성하였다. 땅콩새싹 추출물 처리에 따른 유전자 발현을 분석하기 위해, LightCycler FastStart DNA Master PLUS SYBR Green I(Roche, Basel, Switzerland)과 타깃 유전자에 특이적인 primer (Table 2)를 사용하여 real-time polymerase chain reaction (RT-PCR)을 수행하였다. 95°C에서 10분간 초기 변성 후, 95°C에서 15초, 60°C에서 10초, 72°C에서 10초를 45회 반복하였다. 단, involucrin 유전자의 경우, annealing 온도를 64°C로 설정하였다. 각 유전자의 발현 수준은 β-actin 유전자의 발현을 내재 대조군(reference gene)으로 하여 상대 정량(ΔΔCt 방법)으로 산출하였다.

Table 2. Primer sequences for real time-polymerase chain reaction (RT-PCR)
Gene Sequence (5’ to 3’)
HAS-2 Forward: GCAGTGTAAGATATTGGATGGC
Reverse: CCCATAAATTCTTGATTGTACCAATCTTC
HAS-3 Forward: TGTCCAGATCCTCAACAAGTACGA
Reverse: CTGGAGGAGGCTGTTGC
Filaggrin Forward: GGCTAAGTGAAAGACTTGAAGAGA
Reverse: AATAGACTATCAGTGGTGTCATAGG
Involucrin Forward: GGCAGCTGAAGTACCTGGAA
Reverse: TCCAGCTGCTCCAGTTG
β-Actin Forward: CACTGTGCCCATCTACG
Reverse: CTTAATGTCACGCACGATTTC
Download Excel Table
2.10. 상처 치유율 평가

HaCaT 세포(2×104 cells/well)를 culture-insert 2-well 24-plate (ibidi, Munich, Germany)에 분주하고 24시간 동안 배양하였다. 이후 plate에서 실리콘을 제거하고, 땅콩새싹 추출물을 포함하는 serum-free 배지에서 8시간 동안 추가 배양하였다. 추출물 처리 전후의 wound area는 광학현미경(ECLIPSE Ti2-U, Nikon, Tokyo, Japan)으로 관찰하였으며, ImageJ(National Institutes of Health, Bethesda, MD, USA) 프로그램으로 분석하여 수치화한 후 상처 치유율(closure rate, %)을 다음식에 따라 산출하였다(Jonkman 등, 2014).

Closure rate (%) =  A B / A × 100

A: 0시간 wound area

B: 8시간 후 wound area

2.11. 통계 분석

본 연구의 모든 데이터는 3회 이상 반복 실험을 수행한 후 평균(mean)과 표준편차(standard deviation, SD)로 나타내었다. 연구 결과의 통계분석은 GraphPad Prism 8 software (GraphPad Software, San Diego, CA, USA) 프로그램을 사용하여 Student’s t-test 및 일원분산분석(one-way ANOVA)를 실시하였고, 사후 검정은 Duncan’s multiple range test를 적용하여 유의수준 p<0.05에서 유의성을 판단하였다.

3. 결과 및 고찰

3.1. 땅콩새싹 추출물의 총폴리페놀 및 총플라보노이드 함량

스마트팜 환경에서 재배한 땅콩새싹을 이용하여 물, 50% ethanol 및 absolute ethanol 추출물을 제조한 후, 총폴리페놀 및 플라보노이드 함량을 측정하였다(Table 3). 물 추출물은 TPC 6.38 mg/g, TFC 2.16 mg/g으로 나타났으며, 50% ethanol 추출물에서는 TPC 30.32 mg/g, TFC 3.25 mg/g으로 물 추출물 대비 각각 약 4.7배, 1.5배 높은 함량을 보였다. Absolute ethanol 추출물에서는 TPC 78.06 mg/g, TFC 6.54 mg/g으로 가장 높은 함량을 나타내며, 물 추출물 대비 각각 약 12.2배와 3배 증가하였다. 이는 ethanol의 극성 차이가 다양한 페놀성 화합물의 용해도를 높이는 것을 시사한다. Adhikari 등(2018)은 국내의 6가지 땅콩 품종(대광, 아광, 백중, 알로기, 풍안, 흑땅콩)을 22-25°C에서 9일 동안 물만 공급하여 재배한 땅콩새싹의 methanol 추출물의 TPC와 TFC가 각각 0.23-0.32 mg/g과 0.05-0.11 mg/g 범위라고 보고하였다. 한편, Lee 등(2024)은 전북 고창에서 재배한 땅콩으로 6-7일 동안 재배한 땅콩새싹의 absolute ethanol 추출물의 TPC와 TFC가 434 mg/g과 536 mg/g으로 보고하였다. 이와 같은 차이는 땅콩새싹의 재배 지역, 품종, 재배 기간 및 방법, 그리고 추출 용매와 조건의 차이에 기인할 수 있다. 특히 본 연구에서 사용된 땅콩새싹은 온도(25±1°C)와 상대습도(60-70%)를 일정하게 유지하고, 광주기를 정밀하게 조절한 스마트팜 환경에서 재배된 시료로서, 이러한 환경 제어 요인들이 기능성 성분 축적에 영향을 미쳐 기존 보고와 상이한 결과를 보였을 가능성이 있다.

Table 3. Total polyphenol content (TPC) and total flavonoid content (TFC) of the peanut sprout extracts
Extract TPC (mg/g) TFC (mg/g)
Water 6.38±0.201)a2) 2.16±0.05a
50% ethanol 30.32±0.33b 3.25±0.27b
Absolute ethanol 78.06±2.52c 6.54±0.34c

1) All values are mean±SD (n=3).

2) Different superscript letters within a column indicate significant differences by one-way ANOVA and Duncan’s multiple range test (p<0.05).

Download Excel Table
3.2. 땅콩새싹 추출물의 유효성분 함량

Resveratrol과 polydatin은 땅콩을 포함한 여러 식물에 존재하는 스틸벤계 폴리페놀 화합물로 땅콩이 발아함에 따라 그 함량이 증가하는 것으로 알려져 있다(Seo 등 2013; Wang 등 2005). 이 화합물들은 항산화, 항염증, 항염, 심혈관 보호 등 다양한 생리활성을 나타내는 것으로 보고되고 있으며(Kang 등, 2010; Karami 등, 2022; Meng 등, 2020), 피부에서는 항노화, 재생, 미백, 주름개선 등의 효과가 보고되고 있다(Cui와 Wang, 2025; Jin 등, 2011). 본 연구에서는 LC-MS/MS를 활용하여 스마트팜 환경에서 재배한 땅콩새싹 추출물의 resveratrol과 polydatin의 함량을 측정하여 Table 4에 나타내었다. 50% ethanol 추출물의 resveratrol 및 polydatin의 함량은 4.71 μg/g 및 3.14 μg/g으로 가장 높았으며, absolute ethanol 추출물은 4.58 μg/g 및 2.45 μg/g으로 50% ethanol 추출물과 비슷한 수준이었다. 물 추출물의 함량은 각각 1.30 μg/g과 1.13 μg/g으로 가장 낮았다. 이러한 결과는 50% ethanol 용매가 중간 극성을 지녀 친수성과 소수성 성분 모두를 효율적으로 용출시켰기 때문으로 판단된다. 기존 재배 방식으로 얻은 땅콩새싹 추출물의 resveratrol과 polydatin 함량에 대한 선행 연구를 살펴보면, Seo 등(2013)은 80% ethanol 추출물의 resveratrol과 polydatin의 함량을 각각 0.06 μg/g과 2.23 μg/g으로 보고하였으며, Lee와 Choi(2021)는 70% ethanol 추출물에서 resveratrol 11.0 μg/g, polydatin 28.4 μg/g으로 보고하였다. 이러한 차이는 사용된 땅콩의 품종, 발아 기간, 재배 환경 및 추출 조건 등에 기인한 것으로 판단된다. 따라서, 재배 땅콩새싹의 유효성분 함량 증진을 위해서는 스마트팜의 환경 제어 요인이 생리활성 물질의 생합성 및 축적에 미치는 영향을 규명하기 위한 보다 정밀한 추가 연구가 필요하다.

Table 4. Resveratrol and polydatin contents of the peanut sprout extracts
Extract Resveratrol (μg/g) Polydatin (μg/g)
Water 1.30±0.141)a2) 1.13±0.14a
50% ethanol 4.71±0.77b 3.14±0.57b
Absolute ethanol 4.58±0.84b 2.45±0.45b

1) All values are mean±SD (n=3).

2) Different superscript letters within a column indicate significant differences by one-way ANOVA and Duncan’s multiple range test (p<0.05).

Download Excel Table
3.3. 땅콩새싹 추출물의 세포독성 평가

땅콩새싹은 항산화, 항염, 미백, 항노화 등의 피부 개선 효능이 보고되어 기능성 화장품 소재로서 잠재력이 있는 것으로 알려져 있다(Choi 등, 2013; Choi 등, 2015; Yoon, 2016). 본 연구에서는 스마트팜 재배 땅콩새싹 추출물의 세포독성, 피부 보습, 장벽 개선 및 재생 효능을 평가하고자 하였다. 먼저 땅콩새싹 추출물의 세포독성을 확인하기 위해 사람 각질형성세포인 HaCaT 세포에 추출물을 농도별로 처리한 후 세포 생존율을 측정하였다(Fig. 1). 땅콩새싹 물 추출물을 25, 50, 100 μg/mL의 농도로 처리한 결과, 세포 생존율은 각각 95.82%, 101.04%, 102.18%로 대조군과 비교하여 유의한 차이가 나타나지 않았다. 50% ethanol 추출물 처리군에서도 세포 생존율은 각 99.93%, 99.58%, 96.89%로 유의한 변화가 관찰되지 않았다. Absolute ethanol 추출물의 경우, 25와 50 μg/mL 처리군에서 세포 생존율은 각각 96.83%, 103.94%로 대조군과 비교하여 유의한 차이가 없었으며, 100 μg/mL 처리군에서는 세포 생존율이 108.09%로 유의미하게 증가하였다. 이러한 결과는 스마트팜 재배 땅콩새싹 추출물이 세포독성을 나타내지 않음을 의미하며, HaCaT, B16F10 melanin, 3T3-L1 및 EA.hy926 세포를 대상으로 한 기존의 연구결과와도 일치하였다(Choi 등, 2013; Lee와 Choi, 2021; Lee 등, 2024; Yoon, 2016). 따라서, 땅콩새싹 추출물은 세포 안전성이 확인되어 화장품 소재로 활용 가능성을 나타냈다.

kjfp-32-6-1200-g1
Fig. 1. Cytotoxic effects of the peanut sprout extracts in HaCaT cells. Cells were treated with different concentration of water, 50% ethanol (EtOH), and absolute EtOH extracts, respectively. All values are mean±SD (n=3). The statistical analysis was carried out by t-test (***p<0.001 vs. control).
Download Original Figure
3.4. 땅콩새싹 추출물의 보습 효능 평가

땅콩새싹 추출물의 보습 효능을 평가하기 위해 HaCaT 세포에 각 추출물을 100 μg/mL로 처리한 후 보습 관련 유전자인 HAS-2 및 HAS-3의 mRNA 발현 변화를 RT-PCR로 확인하였다(Fig. 2). 그 결과, HAS-2의 발현이 대조군에 비해 땅콩새싹 물 추출물, 50% ethanol 추출물 및 absolute ethanol 추출물 처리군에서 각각 1.8배, 2.4배 및 2.3배 증가하였다. 반면, HAS-3의 발현은 모든 처리군에서 대조군과의 유의한 차이를 나타내지 않았다. HAS는 피부 보습 유지에 필수적인 히알루론산 합성에 관여하는 효소이며, HAS-2는 고분자량 히알루론산(high molecular weight-HA, HMW-HA)을, HAS-3는 저분자량 히알루론산(low molecular weight-HA, LMW-HA)을 합성하는 것으로 보고되어 있다(Juncan 등, 2021; Kavasi 등, 2017; Lierova 등, 2022; Malaisse 등, 2014). 따라서, 땅콩새싹 추출물은 HAS-2 발현을 증가시킴으로써 HMW-HA 합성을 촉진하고 이를 통해 피부 수분 유지에 기여할 것으로 판단된다.

kjfp-32-6-1200-g2
Fig. 2. Effects of the peanut sprout extracts on mRNA expression of skin moisturizing-related genes in HaCaT cells. Cells were treated with 100 μg/mL of water, 50% ethanol (EtOH), and absolute EtOH extracts, respectively. The relative mRNA expressions of HAS-2 (A) and HAS-3 (B) were investigated by RT-PCR. All values are mean±SD (n=3). The statistical analysis was carried out by t-test (**p<0.01 and ****p< 0.0001 vs. control).
Download Original Figure
3.5. 땅콩새싹 추출물의 장벽 효능 평가

땅콩새싹 추출물의 장벽 효능을 평가하기 위해 HaCaT 세포에 각 추출물을 100 μg/mL 농도로 처리한 후 피부 장벽 유지에 중요한 인자인 filaggrin과 involucrin의 mRNA 발현 변화를 RT-PCR로 분석하였다(Fig. 3). 그 결과, filaggrin의 발현은 물 추출물, 50% ethanol 추출물 및 absolute ethanol 추출물 처리군에서 대조군 대비 각각 1.5배, 2.1배 및 1.3배 유의적으로 증가하였으며, 50% ethanol 추출물 처리군에서 가장 높은 발현 증가가 확인되었다. Involucrin의 경우, 물 추출물 및 absolute ethanol 추출물 처리군에서는 유의한 차이가 나타나지 않았으나, 50% ethanol 추출물 처리군에서 유의적으로 대조군 대비 1.4배 증가한 것을 확인하였다. Filaggrin과 involucrin은 각질세포 분화 과정에서 발현되어 케라틴 등 다른 단백질과 결합함으로써 피부 장벽 형성을 위한 단백질 스캐폴드를 구성하는 것으로 알려져 있다(Kim과 Leung, 2018; Robinson 등, 1996; Sandilands 등, 2009). 본 연구에서 50% ethanol 추출물이 filaggrin과 involucrin의 발현을 동시에 증가시킨 결과는 땅콩새싹 추출물이 피부 장벽의 단백질 구조를 강화할 수 있음을 나타낸다. 따라서, 땅콩새싹 추출물은 피부 장벽 강화를 위한 기능성 소재로 활용될 수 있을 것으로 사료된다.

kjfp-32-6-1200-g3
Fig. 3. Effects of the peanut sprout extracts on mRNA expression of skin barrier-related genes in HaCaT cells. Cells were treated with 100 μg/mL of water, 50% ethanol (EtOH), and absolute EtOH extracts, respectively. The relative mRNA expressions of filaggrin (A) and involucrin (B) were investigated by RT-PCR. All values are mean±SD (n=3). The statistical analysis was carried out by t-test (**p<0.01, ***p<0.001 and ****p<0.0001 vs. control).
Download Original Figure
3.6. 땅콩새싹 추출물의 피부재생 효과

땅콩새싹의 피부재생 효능을 조사하기 위해 HaCaT 세포에 땅콩새싹 물 추출물, 50% ethanol 추출물 및 absolute ethanol 추출물을 각각 처리한 후 상처 치유율을 측정하였다(Fig. 4). 그 결과, 물 추출물 처리군의 상처 치유율은 27.6%로 대조군(22.9%)과 비교하여 유의한 차이를 보이지 않았으나, 50% 및 absolute ethanol 추출물 처리군에서는 각각 70.8%와 81.2%로 대조군 대비 현저한 증가가 확인되었다. 피부재생 과정은 염증 억제, 세포 증식과 이동, 조직 재형성 등 복합적인 기전에 의해 조절되며, 이 과정에서 항산화 및 항염 활성이 중요한 역할을 한다(Cañedo-Dorantes와 Cañedo-Ayala, 2019). 또한, 상처 치유 초기 단계에서 HMW-HA가 상처 부위에 축적되며 세포 이동능(cell migration) 및 상처 치유을 촉진한다(Aya와 Stern, 2014; Huang 등, 2018). 본 연구에서 땅콩새싹 50% 및 absolute ethanol 추출물 처리군에서 상처 치유율이 유의하게 증가된 것은 땅콩새싹에 함유된 생리활성 성분의 영향 및 HAS-2의 발현 증가로 설명될 수 있다. 땅콩새싹의 주요 성분인 resveratrol은 항산화 및 항염 활성을 통해 산화 스트레스를 억제하고 세포 증식과 이동을 촉진하여 상처 치유를 유도하는 것으로 보고되었으며(Ratz-Łyko와 Arct, 2019; Xia 등, 2017), resveratrol의 배당체인 polydatin 역시 유사한 활성을 나타내어 피부 항상성 유지와 재생능 향상에 기여하는 것으로 알려져 있다(Gupta 등, 2024). HAS-2의 발현이 땅콩새싹 추출물 처리에 의해 증가함으로써 고분자 히알루론산(HMW-HA)의 생성이 촉진되어 상처 치유 과정이 가속된 것으로 판단된다. 따라서 땅콩새싹 ethanol 추출물에서 관찰된 높은 상처 치유율은 이러한 성분들의 복합적 작용에 기인한 것으로 판단되며, 땅콩새싹 추출물은 피부재생 및 상처 치유 촉진을 위한 기능성 소재로 활용될 수 있을 것으로 사료된다.

kjfp-32-6-1200-g4
Fig. 4. Effects of the peanut sprout extracts on in vitro wound healing. HaCaT cells were scratched and treated with or without the 100 μg/mL of water extract, 50% ethanol (EtOH) extract, and absolute EtOH extracts, respectively. Each image was taken at 0 and 8 h after the treatment (A). Original magnification was ×100. All closure rate was presented as a percentage of the closed area at 8 h relative to the wound area at 0 h (B). The values are mean±SD (n=3). The statistical analysis was carried out by t-test (**p<0.01 and ****p<0.0001 vs. control).
Download Original Figure

4. 요약

본 연구에서는 스마트팜 환경에서 재배한 땅콩새싹 추출물의 피부 효능을 평가하였다. 물, 50% ethanol 및 absolute ethanol 추출물을 제조하여 TPC와 TFC를 분석한 결과, ethanol 농도가 증가할수록 TPC와 TFC가 증가하였으며, absolute ethanol 추출물에서 가장 높은 함량이 확인되었다. 또한, LC-MS/MS 분석을 통해 땅콩새싹의 주요 활성 성분인 resveratrol과 polydatin을 검출하였으며, 50% ethanol 추출물에서 가장 높은 함량을 나타냈다. 세포독성 평가 결과, 모든 추출물은 HaCaT 세포에서 독성을 보이지 않았다. 보습 효능 평가에서는 3종의 추출물 모두 HAS-2 발현을 증가시켰으나 HAS-3 발현에서는 변화가 관찰되지 않았다. 피부 장벽 관련 유전자의 발현 분석 결과, 50% ethanol 추출물이 filaggrin과 involucrin 발현을 동시에 증가시켜 피부 장벽 강화 효과를 확인하였다. 피부재생 효과 평가에서는 50% 및 absolute ethanol 추출물이 상처 치유율을 각각 70.8%와 81.2%까지 증가시켜 대조군 대비 유의적인 개선 효과를 보였다. 이러한 결과는 땅콩새싹 추출물이 피부 보습, 장벽 강화 및 피부재생에 기여할 수 있는 기능성 소재로 활용 가능성이 있음을 시사한다.

Acknowledgements

None.

Conflict of interests

The authors declare no potential conflicts of interest.

Author contributions

Conceptualization: Park CM. Methodology: Park CM, Park SE, Cha GS. Validation: Kim J, So Y. Formal analysis: Park CM, Park SE, Cha GS, So Y. Writing - original draft: Park CM. Writing - review & editing: So Y. Visualization: Park CM. Supervision: Kim J, So Y. Project administration: So Y. Funding acquisition: Kim J.

Ethics approval

This article does not require IRB/IACUC approval because there are no human and animal participants.

Funding

This research was financially supported by the Ministry of Trade, Industry and Energy, Korea, under the “Regional Innovation Cluster Development Program (R&D, P00025398)” supervised by the Korea Institute for Advancement of Technology (KIAT).

References

1.

Adhikari B, Dhungana SK, Ali MW, Adhikari A, Kim ID, Shin DH. Resveratrol, total phenolic and flavonoid contents, and antioxidant potential of seeds and sprouts of Korean peanuts. Food Sci Biotechnol. 27:1275-1284 2018;

2.

Akkem Y, Biswas SK, Varanasi A. Smart farming using artificial intelligence: A review. Eng Appl Artif. 120:105899 2023;

3.

Arya SS, Salve AR, Chauhan S. Peanuts as functional food: A review. J. Food Sci Technol. 53:31-41 2016;

4.

Aya KL, Stern R. Hyaluronan in wound healing: rediscovering a major player. Wound Repair Regen. 22:579-593 2014;

5.

Baker P, Huang C, Radi R, Moll SB, Jules E, Arbiser JL. Skin barrier function: the interplay of physical, chemical, and immunologic properties. Cells. 12:2745 2023;

6.

Candi E, Schmidt R, Melino G. The cornified envelope: A model of cell death in the skin. Nat Rev Mol Cell Biol. 6:328-340 2005;

7.

Cañedo-Dorantes L, Cañedo-Ayala M. Skin acute wound healing: A comprehensive review. Int J Inflamm. 2019:3706315 2019;

8.

Choi DI, Choi JY, Kim YJ, Lee JB, Kim SO, Shin HT, Lee SC. Ethanol extract of peanut sprout exhibits a potent anti-inflammatory activity in both an oxazolone-induced contact dermatitis mouse model and compound 48/80-treated HaCaT Cells. Ann Dermatol. 24:142-151 2015;

9.

Choi JY, Choi DI, Lee JB, Yun SJ, Lee DH, Eun JB, Lee SC. Ethanol extract of peanut sprout induces nrf2 activation and expression of antioxidant and detoxifying enzymes in human dermal fibroblasts: Implication for its protection against UVB-irradiated oxidative stress. Photochem Photobiol. 89:453-460 2013;

10.

Choi MS. Smart farm control system for improving energy efficiency. J Digit Converg. 19:331-337 2021;

11.

Cui Q, Wang H. Resveratrol in dermatological therapy: A critical review of mechanisms, delivery innovations, and clinical frontiers. Clin Cosmet Investig Dermatol. 9:2229-2242 2025;

12.

Durai SKS, Shamili MD. Smart farming using Machine Learning and Deep Learning techniques. Decis Anal J. 3:100041 2022;

13.

Engler N, Krarti M. Review of energy efficiency in controlled environment agriculture. Renew Sustain Energy Rev. 141:110786 2021;

14.

Gupta RK, Wasnik P, Mondal D, Shukla D. Critical role of keratinocytes in cutaneous immune responses. Explor Immunol. 4:502-522 2024;

15.

Ha AW, Kim WK, Kim JH, Kang NE. The supplementation effects of peanut sprout on reduction of abdominal fat and health indices in overweight and obese women. Nutr Res Pract. 22:249-255 2015;

16.

Heo JW, Baek JH. Effects of light-quality control on the plant growth in a plant factory system of artificial light type. Korean J Environ Agric. 40:270-278 2021;

17.

Huang L, Wang Y, Liu H, Huang J. Local injection of high-molecular hyaluronan promotes wound healing in old rats by increasing angiogenesis. Oncotarget. 9:8241-8252 2018;

18.

Hung CH, Chen SD. Study of inducing factors on resveratrol and antioxidant content in germinated peanuts. Molecules. 27:5700 2022;

19.

Jin MH, Jeong ET, Kim MS, Song HJ, Kwak TJ, Park SG, Lee SM. The effects of polydatin isolated from Polygonum cuspidatum on melanogenesis and wrinkle formation. J Soc Cosmet Scientists Korea. 37:327-335 2011;

20.

Jonkman JE, Cathcart JA, Xu F, Bartolini ME, Amon JE, Stevens KM, Colarusso P. An introduction to the wound healing assay using live-cell microscopy. Cell Adh Migr. 8:440-451 2014;

21.

Juncan AM, Moisă DG, Santini A, Morgovan C, Rus LL, Vonica-Ţincu AL, Loghin F. Advantages of hyaluronic acid and its combination with other bioactive ingredients in cosmeceuticals. Molecules. 26:4429 2021;

22.

Kang HI, Kim JY, Park KW, Kang JS, Choi MR, Moon KD, Seo KI. Resveratrol content and nutritional components in peanut sprouts. Food Sci Preserv. 17:384-390 2010;

23.

Karami A, Fakhri S, Kooshki L, Khan H. Polydatin: pharmacological mechanisms, therapeutic targets, biological activities, and health benefits. Molecules. 27:6474 2022;

24.

Kavasi RM, Berdiaki A, Spyridaki I, Corsini E, Tsatsakis A, Tzanakakis G, Nikitovic D. HA metabolism in skin homeostasis and inflammatory disease. Food Chem. Toxicol. 101:128-138 2017;

25.

Kim BE, Leung DYM. Significance of skin barrier dysfunction in atopic dermatitis. Allergy Asthma Immunol Res. 10:207-215 2018;

26.

Kobayashi T, Chanmee T, Itano N. Hyaluronan: metabolism and function. Biomolecules. 10:1525 2020;

27.

Lee HH, Choi SY. Resveratrol and aspartic acid contents and antiadipogenic effect of peanut and peanut sprout extracts. Korean J Plant Res. 34:395-402 2021;

28.

Lee YC, Hwang KH, Han DH, Kim SD. Compositions of Opuntia ficus-indica. Korean J Food Sci Technol. 29:847-853 1997;

29.

Lee YK, Jung YS, Cho EC, Kim DH, Shin KO. Physiological activity and nutritional properties of peanut sprout extracts. J Korean Soc Food Sci Nutr. 53:599-607 2024;

30.

Lierova A, Kasparova J, Filipova A, Cizkova J, Pekarova L, Korecka L, Mannova N, Bilkova Z, Sinkorova Z. Hyaluronic acid: Known for almost a century, but still in vogue. Pharmaceutics. 14:838 2022;

31.

Malaisse J, Bourguignon V, De Vuyst E, de Rouvroit CL, Nikkels AF, Flamion B, Poumay Y. Hyaluronan metabolism in human keratinocytes and atopic dermatitis skin is driven by a balance of hyaluronan synthases 1 and 3. J Invest Dermatol. 134:2174-2182 2014;

32.

Meng X, Zhou J, Zhao CN, Gan RY, Li HB. Health benefits and molecular mechanisms of resveratrol: A narrative review. Foods. 9:340 2020;

33.

Nguyen DTP, Kitayama M, Lu N, Takagaki M. Improving secondary metabolite accumulation, mineral content, and growth of coriander (Coriandrum sativum L.) by regulating light quality in a plant factory. J Hortic Sci Biotechnol. 95:356-363 2019;

34.

Park SK, Lee HL, Kang JY, Kim JM, Heo HJ. Peanut (Arachis hypogaea) sprout prevents high-fat diet-induced cognitive impairment by improving mitochondrial function. Sci Rep. 12:6213 2022;

35.

Proksch E, Brandner JM, Jensen JM. The skin: An indispensable barrier. Exp Dermatol. 17:1063-1072 2008;

36.

Rajkumar J, Chandan N, Lio P, Shi V. The skin barrier and moisturization: Function, disruption, and mechanisms of repair. Skin Pharmacol Physiol. 36:174-185 2023;

37.

Ratz-Łyko A, Arct J. Resveratrol as an active ingredient for cosmetic and dermatological applications: A review. J Cosmet Laser Ther. 21:84-90 2019;

38.

Robinson NA, LaCelle PT, Eckert RL. Involucrin is a covalently crosslinked constituent of highly purified epidermal corneocytes: Evidence for a common pattern of involucrin crosslinking in vivo and in vitro. J Invest Dermatol. 107:101-107 1996;

39.

Sandilands A, Sutherland C, Irvine AD, McLean WHI. Filaggrin in the frontline: Role in skin barrier function and disease. J Cell Sci. 122:1285-1294 2009;

40.

Seo JY, Kim SS, Kim HJ, Liu KH, Lee HY, Kim JS. Laxative effect of peanut sprout extract. Nutr Res Pract. 7:262-266 2013;

41.

Tominaga H, Ishiyama M, Ohseto F, Sasamoto K, Hamamoto T, Suzuki K, Watanabe M. A water-soluble tetrazolium salt useful for colorimetric cell viability assay. Anal Commun. 36:47-50 1999;

42.

Velioglu YS, Mazza G, Gao L, Oomah BD. Antioxidant activity and total phenolics in selected fruits, vegetables, and grain products. J Agri Food Chem. 46:4113-4117 1998;

43.

Wang KH, Lai YH, Chang JC, Ko TF, Shyu SL, Chiou RYY. Germination of peanut kernels to enhance resveratrol biosynthesis and prepare sprouts as a functional vegetable. J Agric Food Chem. 53:242-246 2005;

44.

Xia N, Daiber A, Förstermann U, Li H. Antioxidant effects of resveratrol in the cardiovascular system. Br J Pharmacol. 174:1633-1646 2017;

45.

Yoon MY. A study on peanut sprouts extract as the anti-oxidant activity and the skin whitening cosmetic ingredients. KSBB Journal. 31:14-19 2016;

46.

Zhu T, Yang J, Zhang D, Cai Q, Zhou D, Tu S, Liu Q, Tu K. Germination effects of white LED light and UV-C radiation on stilbene biosynthesis and phytochemicals accumulation identified by UHPLC-MS/MS during peanut (Arachis hypogaea L.) germination. J Agric Food Chem. 68:5900-5909 2020;

Website Renewal Notice


Our website has recently been renewed.

In some cases, images, CSS files, or other settings saved in your browser from previous visits may be reused instead of downloading the latest files. As a result, some pages may temporarily appear incorrectly or may not display properly.

If this occurs, please perform a hard refresh.

 - Windows: Ctrl + F5
 - Mac: Command + Shift + R

If you encounter any errors or difficulties while using the website, please contact us at info@guhmok.com.

Thank you.


I don't want to open this window for a day.

Call for Papers: FSP 2026 Special Topic



I don't want to open this window for a day.